Page 202
Page 202
After the Jupiter Gravity landed, he and Zhou Yuan, along with their hibernation pods, were sent directly back to the base.
"呲呲呲——"
As the hibernation pod lid slowly opened, Fang Jing slowly sat up.
"Welcome back."
Zhao Guangyao stood to the side, a smile on his face.
"Brother Zhao, have we arrived?"
I rubbed my slightly dazed head; the feeling of hibernation was really strange.
He was still in Jupiter's orbit before he went to sleep, but when he woke up, he was back at the Xishan Base!
"Hey kid, you're still confused."
After confirming that Fang Jing and Zhou Yuan were unharmed, Zhao Guangyao grinned, helped them up, patted Fang Jing on the shoulder, and said in a low voice:
"Could it be that I've reached Jupiter's orbit?"
"Welcome back."
"King Sun, take him away and let him recover properly."
……
Xishan Base, underground section, expert group research room.
Fang Jing sat at the computer desk, listlessly typing a string of letters into the computer.
“AACATGAAGGTTTTGGCCAA…”
"Clap!"
As the last letter was typed, Fang Jing breathed a sigh of relief and slumped into his seat.
"Over 100,000 letters! I almost died!"
With a groan, Fang Jing almost collapsed into sleep.
He's been back for half a month, and he comes here every day to enter the letters prompted by the machine.
After evaluation by the expert panel.
This string of letters is indeed a base pair, genetic information!
"Fang, is the input complete?"
Beside Fang Jing stood Dr. Cyril, his head full of white hair, a broad smile on his face.
This is a big shot that Old Zhu specially invited.
He can be considered the strongest biologist in Kyushu!
"Typed out!"
Fang Jing nodded weakly in agreement.
"Alright, let's begin the comparison."
Dr. Hillel nodded and pressed the comparison button on his computer.
Quantum computer, start!
Comparison begins!
The genetic information input by Fang Jing is rapidly being processed by the powerful parallel computing capabilities of quantum computing.
It simultaneously compares the genetic information of all species on Earth!
[Data comparison complete. The genetic information shows a 99.995% similarity to the human gene fragment. Preliminary assessment indicates that it is an incorrectly input human gene fragment, which has been marked.]
Compared to quantum computers, this is actually a fragment of the human genome?!
"Human gene fragments?"
Cyril's eyes widened. He first pulled up the potentially incorrect clips with a puzzled look, and then handed them to Fang Jing.
"Fang, check it and see if you've typed it wrong."
"it is good."
Fang Jing was also stunned at this moment.
Holy crap, human genes?!
what's the situation!
He cautiously entered his consciousness and gently touched the machine.
Familiar letters resurfaced in my mind.
Fang Jing's eyes widened suddenly when he compared them.
"I didn't make a mistake!"
"No mistake?"
Cyril frowned, nodded slowly, and focused his gaze on the "different" fragments.
Since there are differences from human gene segments, Fang did not make a mistake.
Then it can only mean it's not human!
but……
"These gene fragments, although different, are exactly the same as human genes in terms of phenotypic expression."
This confused Cyril even more.
That is,
Although the genes input by different individuals may have different genetic information, the differences in their actual manifestation in an individual organism will be very small.
So small that they are practically indistinguishable!
What is this operation?
Chapter 160 The problem lies with the humans of the New World!
Dr. Cyril carefully analyzed the genetic information displayed by the machine.
He was certain,
The expression of this gene in an individual organism will only show very small differences.
It refers to the differences between organisms that belong to the same genus.
Even smaller than this!
Schreyer did not trust the machine's judgment.
This is definitely not the gene of modern Homo sapiens; that 0.005% genetic information is the evidence!
"Without a doubt, this is an animal belonging to the subfamily Homininae and the genus Homo, which is closely related to us Homo sapiens and can even interbreed. However, if I may be so bold, I still haven't figured out why such traits exist due to the differences in genetic information."
To Cyril, this was extremely strange.
Those genetic information that are completely different from those of humans, when reflected in an individual organism, are exactly the same as human genes.
This is incorrect; it doesn't make sense genetically!
Such information should create individuals who are quite different from real humans!
Whether it's body shape or anything else.
However, the traits expressed by the genes are the same.
It's like... some designer deliberately changed it, just to preserve this genetic information of difference...
Moreover, this genetic information is more efficient.
Designer?
He reported his conjecture to Zhu Lao verbatim.
This is a very serious matter.
This universe has just confirmed that life has no designer and arises randomly from disorder.
And what you did was create a designer for me.
Moreover, they designed genes that are extremely similar to those of humans.
You're here to mess with me, aren't you?!
Startled, Cyril immediately compared the genes of the two waves of Chinese people in the Kyushu world.
He only breathed a sigh of relief when he discovered that their genes were 99.99999% similar to those of Chinese people in this universe.
No problem, the people here are fine.
The problem is with the new world!
Humans in the new world may have been "designed"!
novelraw